| Primary Identifier | MGI:7857007 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr406431 |
| Strain of Origin | Not Specified | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Meis2 enhancer, located downstream, was targeted using sgRNAs (equivalent to CACCGAGTAAGGTGACCAGCAGG and AAAAGAAGCGAAGGTCGGGAGGG) with CRISPR/Cas9 technology, resulting in a 2009 bp deletion. This leads to reduced expression of Meis2 in lateral ganglionic eminence (LGE) subventricular zone (SVZ). |
