| Primary Identifier | MGI:7852267 | Allele Type | Endonuclease-mediated |
| Attribute String | Inducible | Gene | Tcf7l2 |
| Transmission | Germline | Strain of Origin | 129S6/SvEvTac |
| Induced With | doxycycline/tetracycline | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using CRISPR-cas9 technology, a tetO was inserted into intron 3 of the transcription factor 7 like 2, T cell specific, HMG box (Tcf7l2) gene (based on Tcf7l2 ENSMUST00000111656.8). A sgRNA (GTGCGTCTTGGGCTTTCCCC) designed to target the Tcf7l2 locus was used to insert this TRE)mod( sequence (from pTREtight vector) via transient transfection into 129S6/SvEvTac-derived W4 embryonic stem (ES) cells. Endogenous Tcf7l2 mRNA expression and splicing were unaffected. |