|  Help  |  About  |  Contact Us

Allele : Tcf7l2<em1Rudl> transcription factor 7 like 2, T cell specific, HMG box; endonuclease-mediated mutation 1, Christiane Ruedl
Primary Identifier  MGI:7852267 Allele Type  Endonuclease-mediated
Attribute String  Inducible Gene  Tcf7l2
Transmission  Germline Strain of Origin  129S6/SvEvTac
Induced With  doxycycline/tetracycline Is Recombinase  false
Is Wild Type  false
molecularNote  Using CRISPR-cas9 technology, a tetO was inserted into intron 3 of the transcription factor 7 like 2, T cell specific, HMG box (Tcf7l2) gene (based on Tcf7l2 ENSMUST00000111656.8). A sgRNA (GTGCGTCTTGGGCTTTCCCC) designed to target the Tcf7l2 locus was used to insert this TRE)mod( sequence (from pTREtight vector) via transient transfection into 129S6/SvEvTac-derived W4 embryonic stem (ES) cells. Endogenous Tcf7l2 mRNA expression and splicing were unaffected.
  • mutations:
  • Insertion
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele




MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom