| Primary Identifier | MGI:7855055 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Modified regulatory region | Gene | Rr595 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A single nucleotide mutation (GRCm39:chr2:g.147882499A>G), in an intergenic region, was engineered using sgRNAs (equivalent to GCCCCCCCAGTTCCAAGTTTAGG and CACAGAGTCCGCCCCCCACTCGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of human non-coding SNP rs6048205 (NC_000020.11:22578963:A>G), associated with higher fasting-glucose levels and impaired beta cell function. The mutation leads to higher Foxa2 expression levels in pancreatic progenitor cells. |