| First Author | Gangadharan U | Year | 1995 |
| Journal | Mouse Genome | Volume | 93 |
| Issue | 1 | Pages | 155-157 |
| Mgi Jnum | J:24234 | Mgi Id | MGI:71983 |
| Citation | Gangadharan U, et al. (1995) Chromosomal localisation of the 43kDa acetylcholine receptor associated protein in mouse and human. Mouse Genome 93(1):155-157 |
| abstractText | Full text of Mouse Genome contribution: Chromosomal localisation of the 43kDa acetylcholine receptor associated protein in mouse and human. U. Gangadharan1, G.R. Coulton2, S. Malas3 and S.D.M. Brownl; 1. Department of Biochemistry and Molecular Genetics, St. Mary's Hospital Medical School, Imperial College of Science, Technology and Medicine, London W2 lPG, UK.; 2. Department of Biochemistry, Charing Cross and Westminster Hospital Medical School, Fulham Palace Road, London W6 8RF, UK.; 3. Department of Genetics and Biometry, University College London, 4 Stephenson Way, London NW12HE, UK. A 43kDa, nonactin peripheral membrane protein (43k) tightly associated with the cytoplasmic face of the postsynaptic membrane at areas of high nicotinic acetylcholine receptor (AChR) density was first identified in the Torpedo electric organ (1). The mouse homologue also found at the neuromuscular junction has been found to share 70% amino acid sequence identity with the Torpedo 43kDa protein (2). It appears that 43k plays a key role in the aggregation of muscle AChR at the postsynaptic membrane (3-5). In order to identify whether 43k underlies any of the many neuromuscular mutations in mouse and human for which the primary protein defect is unknown, we have mapped the 43k gene and shown that it maps to mouse chromosome 2 and human 11p and may be part of an already identified conserved linkage group between these two chromosomes. The chromosomal localisation of the mouse 43k locus - Rapsn (receptor associated protein at the synpase) - was determined by analysis of backcross progeny derived from the European Collaborative Interspecific Backcross - EUCIB (6). 982 progeny were produced from a backcross between C57BLl/6 and Mus spretus and scored for at least 3 anchor markers on each chromosome. Analysis of C57BL/6 and M. spretus variants of backcross progeny derived from EUCIB allows the assignment of any gene to a specific chromosome by the detection of linkage to one of the anchor markers. Using a mouse 43k cDNA (2), a restriction fragment length variant (RFLV) was detected between C57BL/6 and M. spretus parental DNAs from the EUCIB backcross. The 43k cDNA detects PvuII fragments of 5.6kb, 5.2kb and 2.3kb in C57BL/6 DNA and PvuII fragments of 7.0kb and 5.4kb were detected in M. spretus DNA. 69 random backcross progeny were analysed for the 43k RFLV and the data entered into the MBx database supporting EUCIB (6). The MBx database identifies significant linkages with all of the anchor markers. Significant linkage was detected with the anchor marker D2Mit11. 13 recombinants were detected out of 69 DNAs analysed giving a genetic distance of 18.8 ± 4.7cM (lod score = 6.3) and localising the Rapsn locus to mouse chromosome 2 (see Fig. 1). In order to confirm the map position and locus order of Rapsn on mouse chromosome 2 with respect to the linked anchor markers, additional microsatellites from mouse chromosome 2, D2Ucl5 and D2Ucl6 (S. Malas, unpublished data and see legend Fig. 1) which mapped within theD2Mit11-DNds3 anchor interval were analysed through the backcross progeny. D2Ucl5 and D2Ucl6 both demonstrated SSLPs between the parental strains (see legend Fig. 1) and were scored through all 69 backcross progeny analysed for the 43k cDNA. Haplotype analysis and minimising the number of observed recombinants indicated a gene order of: D2Mit11 - D2Ucl5 - D2Ucl6 - Rapsn - D2Nds3. Intergenic distances are as indicated in Fig. 1. The most closely-linked marker to Rapsn is D2Ucl6 at genetic distance 10.1 ± 3.6cM. The region between the anchor markers D2Mit11 and D2Nds3 on mouse chromosome 2 appears to cover at least 6 different conserved linkage groups with five human chromosomes including 2q, 1lp, 7p, 15q and 20p (9). Chromosomal localisation of the RAPSN locus in human was carried out using a panel of cell hybrids segregating a number of human chromosomes (see Table 1). Mouse, chinese hamster and human total DNAs were digested with a range of enzymes and probed with the mouse 43k cDNA to identify human and rodent specific fragments for 43k. Human specific bands of 5.3kb and 1.1kb were detected in a PvuII digest (see legend Table 1). Analysis of the hybrid panel with the mouse 43k cDNA showed only one cell line, Jlcl4, which detected the human specific bands (see Table 1). Jlcl4 is a cell line containing a single human chromosome 11 on a chinese hamster background. Hybridisation of cell line Horl 1, which contains 1lq, with the 43k cDNA failed to detect human-specific bands indicating that the RAPSN locus maps to human 1lp. Figure 1. (Legend). Genetic mapping of the Rapsn gene in the mouse. Summary haplotype data from 69 backcross progeny segregating the 43k RFLV. Progeny analysed were derived from backcrosses to both C57BL/6 and M. spretus (6). The haplotypes indicate the chromosome inherited from the Fl female. Filled squares, M. spretus allele; open squares, C57BL/6 allele. EUCIB parental and backcross DNAs were digested with PvuII, electrophoresed on a 0.8% agarose gel, transferred to nylon membrane (Hybond-N) and hybridized with a 32P-labeled 43k cDNA fragment (2) kindly provided by John Merlie. The filters were washed down with 2xSSC, 1% SDS at 65 degrees C prior to autoradiography. RFLVs of 7.0kb and 5.4kb for M. spretus and 5.6kb. 5.2kb and 2.3kb for C57BL/6 were identified in EUCIB parental DNAs using the 43k cDNA probe. Microsatellites D2Mitll and D2Nds3 were anchor markers scored through the entire backcross progeny set of the EUCIB backcross (see Ref. 6). Primers for microsatellites D2Ucl5 and D2Ucl6 were: D2Ucl5: TCACTGCATATGAGCAGTGAGGA and ACAGTGGAAGCCACTAAACAGGT with allele sizes: C57BL/6, 225bp and M. spretus, 245bp D2Ucl6: GCTGCGGGCACTACACTAAA and GCTTGCCAGAATGTCCCTTG with allele sizes: C57BL/6, 204bp and M. spretus, 220bp Microsatellites were amplified in 25ul PCR reactions containing 0.2mM deoxynucleotides, 0.5mM MgCl2 optimised PCR buffer (Dynozyme), 125ng of each primer and 1.25units of Taq Polymerase (Amplitaq, Perkin Elmer Cetus). The samples were incubated in a Hybaid Omnigene thermocycler and PCR reactions proceeded for 35 cycles of denaturation at 96 degrees C for 30 seconds, annealing at 55-60 degrees C for 90 seconds, extension at 72 degrees C for 90 seconds with final extension at 72 degrees C for 10 minutes. PCR products were scored on Visigels (Stratagene) containing ethidium bromide. We have mapped the 43k gene to mouse chromosome 2 and to human 11p. The localisation to mouse chromosome 2 is in agreement with a recent report by Gautam et al. (8). On mouse chromosome 2 a conserved linkage group with human 1lp encompasses a region extending approximately 10-17cM distal of D2Mitl1 according to the latest consensus genetic map from the Chromosome Committee for Mouse 2 (9). Rapsn maps 18.8 ± 4.7cM distal of D2Mit11. Thus, Rapsn may be a new member of this conserved linkage group between mouse chromosome 2 and 11p. To date, no known mouse or human neuromuscular mutations map in the vicinity of Rapsn on mouse 2 and human 1lp. We thank John Merlie for providing the 43k mouse cDNA probe; Leslie Rooke for hybrid DNAs; Isik Yulug for help and support and Emma Tarttelin for providing the EUCIB backcross service. UG is supported by a Science and Engineering Council studentship. This work was partly supported by grant G9309275MB from the Medical Research Council, UK. REFERENCES 1. Porter, S. and Froehner, S.C. (1983). Characterization and localisation of the Mr = 43,000 proteins associated with acetylcholine receptor-rich membranes. J. Biol. Chem 258: 10034-10040. 2. Frail, E.F,, Mclaughlin, L.L., Mudd, J. and Medie, J.P. (1988). Identification of the mouse 43,000-Dalton acetylcholine receptor-associated protein (RAPsyn) by cDNA cloning. J. Biol. Chem 263: 15602-15607. 3. Phillips, W.D., Kopta, C., Blount, P., Gardner, P.D., Steinbach, J.H. and Merlie, J.P. (1991). Ach receptor-rich membrane domains organized in fibroblasts by recombinant 43-kilodalton protein. Science. 251: 568-570. 4. Brennan, C., Scotland, P.B., Froehner, S.C. and Henderson, L.P. (1992). Functional properties of acetylcholine receptors coexpressed with the 43k protein in heterologous cell systems. Dev. Biol. 149: 100-111. 5. Froehner, S.C., Luetje, C.W., Scotland, P.B. and Patrick, J. (1990). The postsynaptic 43k protein clusters muscle nicotinic acetylcholine receptors in Xenopus oocytes. Neuron. 5: 403-410. 6. The European Backcross Collaborative Group. (1994). Towards high resolution maps of the mouse and human genomes - a facility for ordering markers to 0.lcM resolution. Hum. Molec. Genet. 3: 621-627. 7. Yulug, I.G., Egan, S.E., See, C.G. and Fisher, E.M.C. (1994). Mapping GRB2, a signal transduction gene in the human and the mouse. Genomics 22: 313-318. 8. Gautam, M., Mudd, J., Copeland, N.G., Gilbert, D.J., Jenkins, N.A. and Merlie, J.P. (1994). Characterisation and mapping of the Rapsn gene encoding the 43-kDa acetylcholine receptor-associated protein. Genomics 24: 366-369. 9. Siracusa, L.D. and Abbott, C.M. (1993). Mouse chromosome 2. Mammalian Genome 4: S31-S46. Table 1. Assignment of the mouse 43k gene to human chromosome 11p using a somatic cell hybrid mapping panel. Human Chr.: 1 + X; Result: -; Cell Line: GM07299; Human Chr.: 2; Result: -; Cell line: GM10826B. Human Chr.: 3; Result: -; Cell Line: GM10253; Human Chr.: 4; Result: -; Cell line: HHW416 [Nature 300:765]. Human Chr.: 5; Result: -; Cell line: GM10114; Human Chr.: 6p21-qter+Xq; Result: -; Cell line: MCP6BRA. Human Chr.: 7; Result: -; Cell Line: Clone 21E; Human Chr.: 8; Result: -; Cell line: C4a. Human Chr.: 9; Result: -; Cell line: GM10611; Human Chr.: 10+Y; Result: -; Cell line: 7628a [Am. J. Hum. Genet. 40:503]. Human Chr.: 11; Result: +; Cell line: Jlc14 [Nature 299:747]; Human Chr.: 12+X+21; Result: -; Cell line: IaA9602+ve. Human Chr.: 13 [traces 8, 11, 12]; Result: -; Cell line: 289; Human Chr.: 14+16p13.1-q22.1; Result: -; Cell line: GM10479. Human Chr.: 15+11q[plus part of Xp and prox. Xq]; Result: -; Cell line: Horl 1; Human Chr.: 16; Result: -; Cell line: 2860H7. Human Chr.: 17; Result: -; Cell Line: PCTBA 1.8; Human Chr.: 18; Result: -; Cell line: DL18TS [Genomics 14:431]. Human Chr.: 19; Result: -; Cell Line: GM10612; Human Chr.: 4, 20 and X; Result: -; Cell line: GM10478. Human Chr.: 21q + X; Result: -; Cell line: THYB1.3.3; Human Chr.: 22 + part of Xp; Result: -; Cell line: PGME25nu [Nature 300: 765]. Human Chr.: X; Result: -; Cell line: Horl9X; Human Chr.: Y; Result: -; Cell line: 853. Hybrid DNAs were obtained from Lesley Rooke (ICRF, Clare Hall, UK) - Further details of all hybrids are available in Ref. 7 aside from those indicated where the relevant reference is supplied. Chromosome 6pter-6p2l is not included in this panel. 20ug of the cell hybrid DNAs and 10ug of control (total human, mouse and chinese hamster) DNAs were digested with PvuII, electrophoresed on 0.8% agarose gels, transferred to nylon membranes (Hybond-N) and hybridized with32P-labeled mouse 43k cDNA fragment (2). The filters were washed down to 0.1xSSC, 1%SDS at 65 degrees C prior to auto- radiography. Bands of 5.3kb and l.1kb were detected in the total human DNA lane, bands of 11.2kb. 3.8kb and 2.7kb were detected in total chinese hamster DNA lane and bands of 5.6kb, 5.2kb and 2.3kb were detected in total mouse DNA. Human-specific fragments of 5.3kb and 1.1kb were detected only in the cell hybrid Jlc14, containing chromosome 11 alone on a chinese hamster background. |
