| First Author | Lueders KK | Year | 1992 |
| Journal | Mouse Genome | Volume | 90 |
| Issue | 3 | Pages | 436-38 |
| Mgi Jnum | J:2519 | Mgi Id | MGI:51041 |
| Citation | Lueders KK (1992) Mapping of GLN retrotransposon LTR sequences in the BXD RI series. Mouse Genome 90(3):436-38 |
| abstractText | Full text of Mouse Genome contribution: MAPPING OF GLN RETROTRANSPOSON LTR SEQUENCES IN THE BXD RI SERIES. Kira K. Lueders; Laboratory of Biochemistry, National Cancer Institute, National Institures of Health, Bethesda, MD 20892, USA. Introduction In an effort to develop new multilocus probes, oligonucleotide probes based on sequences in the GLN retrotransposon family (1) have been examined. The GLN family is composed of recombinant retrovirus-like elements that contain non-VL30 LTRs flanking VL30 internal sequences, and have an unusual primer-binding site homologous to tRNA Gln. GLN family members have been shown to be particularly polymorphic in their LTR sequences (1). Oligonucleotide probes were made from variable sequences in the U5 regions of the LTRs of three GLN elements sequenced by Itin and Keshet (1). Seven polymorphic elements are identified here, and mapping of five of these in the BXD RI set of mice is presented. Materials and Methods Custom-synthesized oligonucleotides were supplied by Juanita Eldridge (Laboratory of Biochemistry, NCI). The 23-nucleotide probes had the following sequences: GLN3, CCGATTCGACGTGTACCCAAGAA; GLN2, CCAATTCGGCGTGCACCCAAGAA; VL8, CCGATTCGGTGGGCACCCAAGAA. These sequences are the complement of those presented in Fig. 4 of reference 1. Inbred mouse DNAs and those from the C57BL/6J x DBA/2J (BXD) RI set were purchased from The Jackson Laboratory. Mus spretus DNA was a gift from Beverly Mock, NCI. Restriction digestion of DNAs, agarose gel electrophoresis, and hybridization of oligonucleotide probes to dried gels were done as previously described (2, 3). Data were analyzed using the RI Manager2.2 program (4). Results The oligonucleotide probes were hybridized to HindIII digested DNAs from 5 strains of mice. The GLN3 probe detected 8 fragments in genomic DNA from each of the inbred strains of mice tested, and 6 fragments in Mus spretus DNA. GLN2 and VL-8 hybridized to a large number of fragments that were relatively non-polymorphic, making these oligonucleotides less useful as multilocus probes. Since a HindIII site is present in the LTR upstream of the GLN3 probe sequence, the patterns represent 3'LTR junction fragments with flanking DNA. DNAs from BALB/cJ, C3HJ, A/J, and DBA/2J strains had very similar patterns with the GLN3 probe. The pattern for C57BL/6J was sufficiently different to permit mapping of a number of the GLN3 proviruses in the BXD set of RI strains. Four proviral loci in C57BL/6J (Gln3-1 to Gln3-4) and 3 proviral loci in DBA/2J (Gln3-5 to Gln3-7) were polymorphic, and the strain distribution patterns (SDPs), sizes of the HindIII fragments and the chromosomal (Chr) locations for these proviruses are shown in Table 1. TABLE 1. Locus: Gln3-1; SDP BXD RI SET: 1: D; 2: B; 5: B; 6: B; 8: B; 9: B; 11: B; 12: B; 13: D; 14: B; 15: D; 16: B; 18: B; 19: B; 20: B; 21: D; 22: D; 23: B; 24: D; 25: D; 27: B; 28: B; 29: B; 30: B; 31: B; 32: B; Chr.: 4; # discordant/total: 0/26 Mup-1. Locus: Gln3-2; SDP BXD RI SET: 1: B; 2: B; 5: B; 6: B; 8: B; 9: B; 11: D; 12: B; 13: D; 14: B; 15: D; 16: B; 18: D; 19: D; 20: B; 21: B; 22: D; 23: B; 24: B; 25: D; 27: D; 28: B; 29: B; 30: D; 31: B; 32: D; Chr.: ?. Locus: Gln3-3; SDP BXD RI SET: 1: D; 2: D; 5: D; 6: D; 8: B; 9: B; 11: D; 12: D; 13: D; 14: B; 15: B; 16: B; 18: B; 19: D; 20: D; 21: D; 22: D; 23: D; 24: B; 25: B; 27: B; 28: D; 29: D; 30: B; 31: B; 32: B; Chr.: 6; # discordant/total: 3/26 IL5-R. Locus: Gln3-4; SDP BXD RI SET: 1: D; 2: B; 5: D; 6: D; 8: B; 9: D; 11: D; 12: B; 13: B; 14: B; 15: B; 16: D; 18: D; 19: B; 20: B; 21: D; 22: D; 23: B; 24: D; 25: D; 27: D; 28: D; 29: B; 30: D; 31: D; 32: D; Chr.: 17; # discordant/total: 0/26 D17Leh173. Locus: Gln3-5; SDP BXD RI SET: 1: B; 2: B; 5: B; 6: D; 8: D; 9: B; 11: B; 12: B; 13: B; 14: B; 15: D; 16: D; 18: B; 19: D; 20: B; 21: B; 22: B; 23: B; 24: B; 25: D; 27: D; 28: D; 29: D; 30: D; 31: B; 32: D; Chr.: 1; # discordant/total: 0/26 Idh-1. Locus: Gln3-6; SDP BXD RI SET: 1: B; 2: B; 5: B; 6: B; 8: B; 9: B; 11: D; 12: B; 13: D; 14: B; 15: D; 16: B; 18: D; 19: D; 20: B; 21: B; 22: D; 23: B; 24: B; 25: D; 27: D; 28: B; 29: B; 30: D; 31: B; 32: D; Chr.: ?. Locus: Gln3-7; SDP BXD RI SET: 1: D; 2: B; 5: D; 6: D; 8: B; 9: D; 11: D; 12: B; 13: B; 14: B; 15: B; 16: D; 18: D; 19: B; 20: B; 21: D; 22: D; 23: B; 24: D; 25: D; 27: D; 28: D; 29: B; 30: D; 31: D; 32: D; Chr.: 17; # discordant/total: 0/26 D17Leh173. Sizes of the GLN3 HindIII fragments were as follows: Gln3-1, 20 kb; Gln3-2, 4.7 kb; Gln3-3, 4.6 kb; Gln3-4, 3.4 kb; Gln3-5, 12.0 kb; Gln3-6, 4.9 kb; Gln3-7, 1.9 kb; B, C57BL/6 and D, DBA/2 strains. Gln3-1 to Gln3-4 are proviruses in the C57BL/6 strain, and Gln3-5 to Gln3-7 are proviruses in the DNA/2 strain. Numbers in the last column show the number of RI strains per total strains analysed for which the SDP pattern was discordant with the nearest marker. Gln3-4 and Gln3-7 had identical SDPs and cosegregated with a marker on Chr 17. Gln3-2 and Gln3-6 also had identical SDPs, but did not map with known markers. Gln3-1 and Gln3-5 cosegregated with markers on Chr 4 and Chr 1, respectively. Gln3-3 had three crossovers with the nearest marker, Il5-R (5), on Chr 6. Discussion A general GLN LTR probe detects approximately 1000 solitary LTRs of this type in the mouse genome (1, 6). GLN LTRs have extensive homology with a solitary LTR isolated from the mouse c-mos locus (6). The GLN LTR near Mos differs in sequence from the GLN3 oligonucleotide probe in three nucleotides and thus would not be detected. The element-specific oligonucleotide probe described here shows that there are relatively few GLN elements with the GLN3 sequence motif. The mapping data presented here provide 5 new markers, and Gln3-2 and Gln3-6 define a new linkage group for the BXD RI set. References 1. Itin, A. & Keshet, E. (1986) J. Virol. 59:301-307. 2. Mietz, .J.A. & Kuff, E.L. (1992) Mammalian Genome, in press. 3. Lueders, K.K., Frankel, W.N., Mietz, J.A. & Kuff, E.L. Mammalian Genome, submitted. 4. Manly, K.F. & Elliott, R.W. (1991) Mammalian Genome 2:123-126. 5. Gough, N.M. & Rakar, S. (1992) Genomics 12:855-856. 6. Propst, F. & Vande Woude, G.F. (1984) Nucleic Acids Res. 12:8381-8392. |
