| First Author | Abbott C | Year | 1992 |
| Journal | Mouse Genome | Volume | 90 |
| Issue | 1 | Pages | 86 |
| Mgi Jnum | J:22 | Mgi Id | MGI:48563 |
| Citation | Abbott C (1992) Length variation in a dinucleotide repeat in the murine Pax-1 gene on chromosome 2. Mouse Genome 90(1):86 |
| abstractText | Full text of Mouse Genome contribution: LENGTH VARIATION IN A DINUCLEOTIDE REPEAT IN THE MURINE PAX-1 GENE ON CHROMOSOME 2. Cathy Abbott. Department of Genetics & Biometry, University College London, Wolfson House, 4 Stephenson Way, London NWl 2HE. INTRODUCTION: Mutations in the murine gene have been shown to be associated with the developmental mutation undulated (un)1. The Pax-1 gene has been mapped to mouse chromosome 2(2). Recently, the full-length sequence of the mouse Pax-1 cDNA was published(l). The 3' untranslated region of the gene contains a TC dinucleotide repeat; in the published sequence, (C57BL/6Nimr)3, the repeat consists of an uninterrupted run of (TC)31 preceded by a TC rich region. Since relatively few microsatellite sequences have been described for mouse chromosome 2(4,5), PCR primers were designed to flank this TC rich region. These were used to amplify the region by PCR using DNA from a number of inbred strains and Mus spretus. MATERIALS AND METHODS: PCR was carried out using lug DNA in 10x Promega buffer adjusted to 2mM Mg2+ with 200uM dNTPs, 50 pmol each primer, lug DNA and lu Taq polymerase. After an initial denaturation step at 95 degrees C for 5 minutes, 32 cycles were carried out. Each cycle was 95 degrees C 15 seconds, 52 degrees C 1 minute, 72 degrees C 1 minute 30 seconds. The products were then analysed by agarose gel electrophoresis using 4% NuSieve agarose in 1x TBE, stained with ethidium bromide and viewed under uv light. RESULTS: The primers give a PCR product of around the expected size (266 bp) in DNA from C57BL/6J, C3H/HeJ and DBA/2J mice. DNA from Mus spretus gave a smaller band of around 220 bp. The TC rich region is presumably, therefore, variable in length between mouse species. The primers can thus be used for mapping the Pax-1 gene in interspecific backcrosses between C57BL/6J, DBA/2J or C3H/HeJ and Mus spretus. REFERENCES: 1. Chalepakis, G., Fritech, R., Fickenecher, H., Deutsch, U., Goulding, M. and Gruss, P. Cell 66, 873-884, 1991. 2. Siracusa, L. et al. Genomics 6, 491-504, 1990. 3. Fahrner, K., Hogan, B. and Flavell, R. EMBO J. 6, 1265-1271 1987. 4. Love, J., Knight, A., McAleer, M. and Todd, J. Nucl. Acids Res. 18, 4123-4130, 1990. 5. Cornall, R., Aitman, T., Hearne, C. and Todd, J. Genomics 10, 874-881, 1991. FIGURE LEGEND: Pax-1 PCR products from C57BL/6J (B), C3H/HeJ (H), DBA/2J (D) and M. spretus (S) after analysis on a 4% NuSieve agarose gel. M = 1 kb ladder (BRL) The primer sequences used were:- 5'GACTCCTGCATCCACCTCAA 3' and 5'AGCCTAGGGAAGCTGTAAAG |
