| First Author | Ball ST | Year | 1997 |
| Journal | Mouse Genome | Volume | 95 |
| Issue | 4 | Pages | 878-81 |
| Mgi Jnum | J:45470 | Mgi Id | MGI:1195491 |
| Citation | Ball ST, et al. (1997) Identification of a Y Chromosome specific sequence DYH1. Mouse Genome 95(4):878-81 |
| abstractText | Full text of Mouse Genome contribution: IDENTIFICATION OF A Y CHROMOSOME SPECIFIC SEQUENCE DYHI. S.T. Ball, C.M. Williamson, S.H. Laval, E.R. Dutton and J. Peters. Mammalian Genetics Unit, Medical Research Council, Harwell. Didcot, OX11 ORD, UK. Introduction The mammalian Y chromosome is rich in repetitive sequences; one notable repeat element, of which there are about 500 copies, contains a retroviral genome (murine retrovirus as well as a sequence called YB10 (6). Recently it has been shown that this repeat is more than 25 kb in size and contains full length copies of a second retroviral genome, IAPE-Y (7), and overall the repeat could account for up to 20% of the M. musculus Y chromosome. A number of other repeat sequences are listed in the latest Y chromosome committee report (2) including twelve recently described repeat elements, six of which are completely novel (12). Variation in repetitive sequences and the Y linked genes Zfy1 and Zfy2 has been used in investigations of the taxonomy of M. musculus and the origin of inbred strains. It has been shown that the Y chromosome of M. musculus can be divided into two types (musculus and domesticus) (1;8;10;13;15;16;17) with M. m. domesticus carrying a domesticus type Y chromosome and M. m. castaneus, M. m. molossinus and M. m. musculus carrying a musculus type Y chromosome. About 75% of inbred strains carry a musculus type Y and 25% a domesticus type Y (10;13;16). Furthermore, the Y chromosome of M. m. molossinus can be distinguished from M. m. castaneus and M. m. musculus by a TaqI RFLP in the sex-determining region gene Sry (10;11), and this molossinus type Y chromosome appears to be derived from M. m. musculus and is present in most inbred strains (10). We describe here a new Y specific repetitive sequence, DYH1, that distinguishes musculus and domesticus type Y chromosomes in classical inbred strains and can be scored using PCR. Materials and Methods. DNA was prepared by standard procedures from stocks and inbred strains held in the colony at the MGU Harwell or purchased from the Jackson Laboratory. DNA from wild caught M. m. molossinus was donated by Dr T Shiroishi, National Institute of Genetics, Mishima, Japan. EcoR1 digests of genomic DNA from selected strains were probed with DYH1(see below) and the filter washed to a stringency of 0.1 x SSC at 63 degrees C. Primers for PCR were derived from nucleotides 19 Ð 40 and 355 - 376, respectively, of the coding sequence of the transforming allele of human KRAS2 (9). The forward primer was 5'-GTGGTAGTTGAAGCTGTTGGC-3Õ and the reverse was 5Õ-TACTGTTCTGGAAGGCAAATC-3Õ. Thirty cycles of PCR were carried out using an annealing temperature of 50 degrees C. For isolating a DYH1 probe, genomic DNA from a DBA/2O1a/e male was amplified using the DYH1 primers, and 1ul of the PCR product was ligated to pGEM-T vector (Promega Corp.) and the ligation mix was transformed into E. coli XL1-Blue (Stratagene). Individual colonies were screened by PCR using the DYH1 primers for the presence of the Y specific insert. The DYH1 insert was amplified by PCR from the pGEM-T vector, the product run out on an agarose gel and retrieved using GENECLEAN (Stratech Scientific Ltd). Gel purified DNA (25 ng) was radiolabelled with 25uCi [alpha-32P]dATP (3000 Ci/mmol, ICN Flow) using the Megaprime kit (Amersham) and the DYH1 primers instead of the random primers. DYH1 was sequenced using the Sequenase kit (United States Biochemical Corp.). Results The DYH1 primers were derived from human KRAS2 for experiments directed towards mouse Chr 2. They amplified several sequences in the mouse including one of 516 bp specific to males with a musculus type Y Chr (Fig. 1, Table 1). Other bands were not investigated further. The 516 bp band was amplified in DNA from males of laboratory strains carrying the three different types of musculus type Y chromosome identified previously (16). The band was also found in M. m. molossinus males from three different localities in Japan, but not in inbred M. m. molossinus (MOLC/Rk and MOLD/Rk) males. The band was not seen in males from strains carrying the three different domesticus type Y chromosomes identified previously (16), nor in M. m. castaneus (MCA) males, nor in DNA from females. However the band was found in males of two other strains, 101/H and HY.FaCtm whose Y chromosome status has not been reported previously. From results with other Y Chr markers, 101/H carries a M. m. musculus Y Chr (S. Laval, pers. comm.), and the results reported here indicate that JU/FaCt does as well. Thus the band appears to be specific to laboratory mice with a musculus type Y Chr and M. m. molossinus samples from Japan and has been given the locus symbol DYHI. Table 1. Amplification of DYHI Strain: BALB/c; Origin: Inbred Laboratory mouse(a); DYH1 amplified: +; Expected classification of Y chromosome: musculus. Strain: C57BL/6J; Origin: Inbred Laboratory mouse(a); DYH1 amplified: +; Expected classification of Y chromosome: musculus. Strain: 129/SV-SCJ-CP/e; Origin: Inbred Laboratory mouse(a); DYH1 amplified: +; Expected classification of Y chromosome: musculus. Strain: HRS/J; Origin: Inbred Laboratory mouse(b); DYH1 amplified: +; Expected classification of Y chromosome: musculus. Strain: CBA/CaH; Origin: Inbred Laboratory mouse(a); DYH1 amplified: +; Expected classification of Y chromosome: musculus. Strain: C3H/HeH; Origin: Inbred Laboratory mouse(a); DYH1 amplified: +; Expected classification of Y chromosome: musculus. Strain: DBA/201a/e; Origin: Inbred Laboratory mouse(a); DYH1 amplified: +; Expected classification of Y chromosome: musculus. Strain: SWR/J; Origin: Inbred Laboratory mouse(a); DYH1 amplified: -; Expected classification of Y chromosome: domesticus. Strain: MA/MyJ; Origin: Inbred Laboratory mouse(b); DYH1 amplified: -; Expected classification of Y chromosome: domesticus. Strain: THP; Origin: Laboratory stock(a,d); DYH1 amplified: -; Expected classification of Y chromosome: domesticus. Strain: MCA; Origin: Inbred M.m.castaneus(a); DYH1 amplified: -; Expected classification of Y chromosome: musculus. Strain: MOLC/Rk; Origin: Inbred M.m.molossinus(b); DYH1 amplified: -; Expected classification of Y chromosome: musculus. Strain: MOLD/Rk; Origin: Inbred M.m.molossinus(b); DYH1 amplified: -; Expected classification of Y chromosome: musculus. Strain: M.mol-MSM; Origin: Wild M.m.molossinus(c); DYH1 amplified: +; Expected classification of Y chromosome: musculus. Strain: M.moI-Hkz; Origin: Wild M.m.molossinus(c); DYH1 amplified: +; Expected classification of Y chromosome: musculus. Strain: M.mol-Aizl; Origin: Wild M.m.molossinus(c); DYH1 amplified: +; Expected classification of Y chromosome: musculus. (a)from Harwell (b)from the Jackson Laboratory (c)from Japan (d)THP has a Y chromosome derived from AKR Fig. 1. Legend: A: PCR analysis of DNA from various strains of mice. DBA/201a carries a musculus type Y Chr MOLD/Rk is a strain of M. m. molossinus origin maintained at the Jackson Laboratory, Bar Harbor, Maine, and M.Mol-MSM and M.Mo1-Aizl are wild caught M.m.molossinus. The arrow indicates the position of the 516bp DYH1 band. The no DNA control contained both forward and reverse primers, but no template DNA. B: above products probed with DYH1; signal is only present in those tracks containing Y chromosomal material of musculus type. On probing EcoRl digests of genomic DNA samples, (Fig. 2)., multiple fragments were found in both males and females, with much more intense hybridization in male DNA. Distinctly different restriction fragment patterns were seen in DNA from males with a musculus type Y chromosome compared to males with a domesticus type Y, and one particularly clear difference was that fragments of approximately 1.9 kb and 2.6 kb are specific to males with a musculus type Y, whereas a fragment of 2.1 kb is specific to males with a domesticus type Y (compare lanes a, f, g with lanes c and d). The DYHl fragments specific to the musculus type Y and domesticus type Y were intact in the tracks containing the DNA from mice with deletions of the Y chromosome (Yd1, Yd2, Yd3 and Yd4, Yd5, Yd6 of musculus and domesticus origin respectively) indicating that DYHl lies outside the deletion region. Ydl, Yd2 and Yd3 are believed to carry deletions of the short arm located between Sry and the centromere (5). DYHl is not in the Sxr region on Yp because a mouse which was XXSxra had a restriction fragment pattern typical of a female. Fig 2 Legend. Eco Rl digests of genomic DNA probed with DYHl. Lanes a,f,g,i j,k contain samples from mice with a musculus type Y, and lanes c,dl.m and n contain samples from mice with a domesticus type Y. The sequence for the whole of DYH1 is shown in Fig. 3. Sequence analysis revealed extensive homology (up to 67%) of a region between bases 109 and 213 to the gag gene of a number of viruses but identity with previously described Y chromosome sequences was not found. DYH1 did not hybridize with delta clones containing MuRVY and/or IAPE-Y (data not shown). Discussion We have identified a sequence, DYH1. which shows similarity to many viral sequences and identifies a repetitive sequence on the Y chromosome and an RFLV between males with a domesticus and those with a musculus type Y chromosome. Using PCR, DYHl was only amplified from strains with a musculus type Y chromosome and wild caught M.m.molossinus males. Most laboratory strains are hybrids derived from a minimum of two subspecies, M.m.domesticus and M.m.molossinus (10;16), and have a rnusculus type Y chromosome derived from M.m.molossinus. Thus, as expected, DYHI could be amplified in M.m.molossinus from three different localities in Japan as well as in inbred strains with a musculus type Y. Unexpectedly, DYHl was not amplified in the MOLC/Rk and MOLD/Rk strains which are of of mlossinus origin and derived from the same single male (4). These strains were also found to have a domesticus type Y when classified for the repetitive sequence AC11 whereas other M.m.molossinus samples had a musculus type Y (14), suggesting that the Y chromosome in MOLC/Rk and MOLD/Rk is not typical of M.m.molossinus. M.m.molossinus is a hybrid between M. m. musculus and M.m.castaneus and is indigenous to Japan (3;18). The M.m.musculus giving rise to M.m.molossinus are thought to have come from the Asian mainland neighbouring on Japan because these M.m.musculus, together with M.m.mlossinus and laboratory mice with a musculus type Y, carry a variant allele of Sry absent in other M.m.musculus populations (10,11). The variant allele is not found in any M.m.domesticus and M.m.castaneus mice tested so far, except for a single M.m.castaneus population in Kunming, China (10;11). It will be of interest to ascertain if the distribution of DYH1 is also confined to a few wild populations of M.m.musculus like the variant Sry. DYH1 is easy to score by PCR and is a potentially useful marker for studies of the evolution of wild M.musculus populations. Figure 3. Nucleotide sequence of DYHl 1 GTGGTAGTTGAAGCTGTTGGCCTGGACGTTCTGCTTTTGTAACTCTAGTCAGAGATACCC 60 61 TTAAAGAGACAGATAGATCCTATAACATTTTGTAACATAAAGAATAGTAGTGTAACACCT 120 121 CTATACCTTTCAGAGGTATTCTAAAAACACTGCTGGGGGCTCCTTTTTCTCTTGTAGGAT 180 181 CTCTCTTACCTTGGCCAAATTGGTGGGGCACTGCAGCTCCTTTCAGTCCTATTATCAG 240 241 CCCAGCAGAAAATTGTCAATTGCTCCATATGGTCAGTGTTGTCAGACATGTCAGAGGGAA 300 301 GGCTGCATCATCATTCAGAAGTTTTATTGGTAGTCAATTGGCCCCCAGCATGCTCTTT 360 361 CTTTCCTCTCAGAATCCTCTCCTTCTCCTCTGTGGTGAAAGAATCTGTAGCTGCTGACAG 420 421 TATCCCAAGTAGTCTGAAGAGAGAATATGAGAGATTCCATTAGATTAGCAGGCTAGGTTT 480 481 TCAAAGAAGGGAGGTGATTTGCCTTCCAGAACAGTA 516 The positions of the oligonucleotide primers that yielded products for sequencing are indicated by underlining. Sequence data was confirmed by reading both strands. Acknowledgements We are grateful to J. Jones for synthesising the oligonucleotides, and to M. Plumb and J. Fennelly for blots of lambda clones containing MuRVY and/or IAPE-Y. E. R. Dutton is the recipient of a Studentship from the MRC Human Genome Project. References 1. Bishop, C.E. et a1 (1985). Nature 315:70-72. 2. Bishop, C.E. and Mitchell, M.J. (1996). Mammalian Genome 6:S331-S333. 3. Bonhomme, F. et a1 (1989). Heredity 63:299-308. 4. Bonhomme, F. and Guenet, J.-L. (1996). GVSLM pp1577-1596. 5. Capel, B. et al (1993). Nature Genetics 5:301-307. 6. Eicher, E.M. et a1 (1989). Genetics 122:181-192. 7. Fennelly, J. et a1 (1996). Mammalian Genome 7:31-36. 8. Mardon, G.R. et al (1989). Science 243: 78-80. 9. McCoy, M.S., Bargmann C.J. and Weinberg R.A. (1984). Mol. Cell. Biol. 4:1577-1582. 10. Nagamine, C.M. et a1 (1992). Mammalian Genome 3:84-91. 11. Nagamine, C.M. et a1 (1994). Mol. Biol. Evol. 11:146-153. 12. Navin, A. et al (1996). Genomics 36:349-353. 13. Nishioka, Y. (1988). Genet. Res., Camb. 52:145-150. 14. Nishioka, Y. and Lamothe, E. (1987). Genet. Res., Camb. 50:195-198. 15. Nishioka, Y. et a1 (1994). Mol. Biol. Evol. 11:146-153 16. Tucker, P.K et al (1992). Mammalian Genome 3:254-261. 17. Wardell, B.B et a1 (1993). Mammalian Genome 4:109-112. 18. Yonekawa, H. et a1 (1986). Current topics in Microbiology and Immunology 127:62-67. |
