| Experiment Id | E-MEXP-2829 | Name | Transcription profiling by array of mouse wild type and Prss16 knockouts |
| Experiment Type | transcription profiling by array | Study Type | WT vs. Mutant |
| Source | ArrayExpress | Curation Date | 2019-03-22 |
| description | Transcription profiling of Prss16 Tssp can be used to evidentiate further endopeptidase genes candidate to self-peptide generation in the thymus. All mice studied were C57BL/6 background and KO (knockout) Prss16-deficient mice were previously obtained by homologous recombination in embryonic stem (ES) cells of a targeting vector carrying Neo resistance gene marker, which has allowed replacement of exons 8 to 12 of the Prss16 gene in KO mice (data not shown). Briefly, one properly targeted ES clone was injected into BALB/c blastocysts to generate chimeric mice. Chimeric males were mated to C57BL/6 females to generate heterozygous pups in which the Neo selection cassette had been excised. Mice heterozygous for the mutation,originally on mixed 129/Sv x C57BL/6 genetic background, were intercrossed to generate homozygous mutants (Prss16-/-), WT (Prss16+/+) and heterozygousmutants (Prss16+/-) littermates. Genotype analysis was performed on genomic DNA from tail biopsies using PCR primers F (5' GCCTGACACAAGTCGCCATAGG 3'), R1 (5' CCAGTTCCTCCCTCAGCACAG 3') and R2 (5' CCAGTAAGAGTGAGGTCCAGAC 3'). The WT Prss16 allele was visualized as a 600 bp fragment using the F-R1 pair of primers, whereas the mutant allele was visualized as a 447 bp fragment using the F-R2 pair of primers. Absence of mRNA expression in the thymus of Prss16-/- mice was confirmed by northern-blot using a cDNA probe (data not shown). The Prss16 deficient mice were crossed onto a C57BL/6 background for eight generations and the thymi of the resulting mice were used for analysis. |