| Primary Identifier | MGI:7423618 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr207838 |
| Strain of Origin | FVB/NRj | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Cardiac-specific Scn5a enhancer Rr207838, part of a super-enhancer between Exog and Scn5a that also contains enhancers Rr207840 and Rr207839, was targeted with sgRNAs (targeting GGTCTGAGTACCGTAGATGA and GGCACTATTTGAGTTCCACT) using CRISPR/Cas9 technology, resulting in its deletion (~2.3 kb sequence total deleted). |
