| Primary Identifier | MGI:8386635 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Inserted expressed sequence, Null/knockout, Reporter | Gene | Ptprg |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A donor vector and gRNA (GTGCGTTTTCGGACATGCGGAGG) were designed to replace the ATG start codon and partial upstream sequence in exon 1 of the endogenous protein tyrosine phosphatase receptor type G (Ptprg) gene with the human PTPRG open reading frame (ORF) cDNA fused with a C-terminal Citrine yellow fluorescent protein sequence and a SV40pA cassette. |
