| Primary Identifier | MGI:6323006 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pstpip2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0319 was generated at The Centre for Phenogenomics by injecting Cas9 D10A endonuclease (nickase) mRNA and four guide RNAs with spacer sequences of TCCACATTTTGCTCGGCTCA and CTGCGTTTTACCTTCCCCAA targeting the 5' side and GTACAGATTCATGGGCCCAC and GCAGGCGGGTGTGAAGCATC targeting the 3' side of exon ENMUSE00000514786 resulting in a 683 bp deletion of Chr18 from 77847885 to 77848568 (GRCm38). |
