| First Author | Wood PA | Year | 1993 |
| Journal | Mouse Genome | Volume | 91 |
| Issue | 2 | Pages | 342-44 |
| Mgi Jnum | J:12812 | Mgi Id | MGI:61030 |
| Citation | Wood PA, et al. (1993) Molecular detection of the Bcd-1 null allele in BALB/cByJ mice by polymerase chain reaction: a simple assay for genetic monitoring. Mouse Genome 91(2):342-44 |
| abstractText | Full text of Mouse Genome contribution: MOLECULAR DETECTION OF THE Bcd-1 NULL ALLELE IN BALB/cByJ MICE BY POLYMERASE CHAIN REACTION: A SIMPLE ASSAY FOR GENETIC MONITORING. Philip A. Wood, Myron E. Hinsdale, C. Lisa Kelly; Department of Comparative Medicine, University of Alabama at Birmingham; Birmingham, Alabama 35294-0019. INTRODUCTION BALB/cJ and BALB/cByJ mice are commonly used and readily obtained from the Jackson Laboratory. Previously, the only method available to distinguish the two sublines was a cellulose acetate electrophoresis assay for the genetic marker butyryl-CoA dehydrogenase (BCD) (1). The Bcd-1 locus, located on mouse chromosome 5, encodes for BCD, also called shortchain acyl-CoA dehydrogenase. There are two electrophoretic allozyme variants found in the various inbred strains. The fast anodally migrating band, representing the Bcd-1a allele, is found in A/J, C57BL/6J, SJL/J, SM/J, and 101/H strains. Likewise, the slow anodally migrating band, representing the Bcd-lb allele, is found in BALB/c, CBA/H, NZB/B1, NZC/B1, and 129/J mice (1). In 1986, Prochazka and Leiter (2) reported that BALB/cByJ mice had a null activity allele at the Bcd-1 locus. In 1989, both Wood et al. (3) and Schiffer et al. (4) independently reported the deficiency of short-chain acyl-CoA dehydrogenase (SCAD) or BCD activity and the biochemical abnormalities associated with this defect. Schiffer et al. (4) demonstrated that the SCAD deficiency mapped to the Bcd-1 locus on chromosome 5. Since then the mouse cDNA for SCAD has been cloned and characterized by Kelly et al. (5) and the null allele, Bcd-lo of BALB/cByJ mice (4), has been shown by Hinsdale et al. (6) to be the result of a 278 bp deletion mutation in the SCAD gene. This mutation results in an antigen negative, null activity allele, as described by Amendt et al. (7). Based on the cloning and molecular characterization of this mutant allele (6), we have now devised a polymerase chain reaction (PCR) assay to distinguish the Bcd-lo null allele from the other two functional alleles. This assay is technically much simpler than the allozyme electrophoresis assay and it provides for a rapid method of testing BALB/c stocks for genetic contamination by BALB/cByJ subline. BALB/cByJ mice are otherwise genetically indistinguishable from the commonly used, but behaviorally and biologically different BALB/cJ mice. MATERIALS AND METHODS Mice. Mice were obtained directly from the vendors as follows. BALB/cJ, BALB/cBy, BALB/cByJ, SJL/J, C57BL/6J were obtained from the Jackson Laboratory; C57BL/6NCr and C3H/HeNCr were obtained from NCI, Frederick; MD. F1 hybrid mice (BALB/cByJ X BALB/cBy, C57BL/6J X SJL/J) were obtained from crosses done in our laboratory. Mice were killed humanely by an anesthesia overdose, and liver was obtained and frozen at Ã80 degrees C for genomic DNA analysis. DNA Analysis. Genomic DNA was prepared by standard methods using proteinase K digestion of tissue and phenol/chloroform/isoamyl alcohol extractions. DNA concentrations were estimated by O.D. at 260nm. The PCR analysis was done by using two primers that flank the deletion as described previously (6). The 5' primer is TAGCGAATTCTGGCGTGCTGCCATGTTGA [Eco RI linker/bp 985--->1003 (5)] and the 3' primer is ACTGCTGCAGCCTTGTGTTCTTGCCTCCGA [PstI linker/bp 1581--->1599 (5)]. The standard PCR reaction consisted of 2 ug of undigested genomic DNA as template with the two primers each at 15 pmol, 0.20mM deoxynucleotides, 5 U Taq polymerase (Perkin-Elmer/Cetus) in a buffer of 50mM KCl, 10mM Tris (pH 8.8), 1.5 mM MgCl, 0.1 % Triton X-100. The PCR was run at 4 min. initial denaturation at 95 degrees C, then 30 cycles of 1 min. at 95 degrees, 1 min. at 57 degrees, and 1 min. at 72 degrees. All amplified DNA bands were separated by standard electrophoresis in a 2% agarose gel with ethidium bromide using TAE buffer. RESULTS. As shown in Figure 1, the Bcd-lo null allele from the BALB/cByJ mice is easily detected in both the homozygous and the heterozygous (F1 hybrid) mice. The PCRs from the heterozygous mice produce both of the expected bands representing the wild-type and mutant alleles. In the strains with either the Bcd-la or the Bcd-lb alleles, both show the larger band indicating that the allozyme differences are not detected by this assay. Therefore, this simple PCR assay readily detects the Bcd-lo null allele. DISCUSSION Since there are some marked biologic and behavioral differences in BALB/cJ and BALB/cByJ mice, and since both strains are routinely obtained from the Jackson Laboratory, it is especially important to be able to readily distinguish these two BALB/c sublines. The only screening test available previously was the BCD allozyme electrophoresis which is laborious and technically difficult to perform. One must kill the mouse and isolate mitochondria from kidney, liver or heart, and assay enzyme extracts. The PCR assay described here is easily done with genomic DNA which could be done as an antemortem test using tail-tip or blood genomic DNA. The PCR primers flank the genomic SCAD deletion. The size difference found here is in agreement with the restriction fragment size differences between these same mice when analyzed by Southern blot using the mouse SCAD cDNA as a probe (6). The assay is designed such that there is a distinct PCR band produced, regardless of genotype and it requires no post PCR restriction enzyme digestion. ACKNOWLEDGMENTS We thank Doug Hamm for assistance with the mouse colony. This work was supported by NIH grant RR-0463. The oligonucleotides were synthesized by the UAB Comprehensive Cancer Center Core Laboratory. Figure 1. (Legend). PCR fragments generated using the SCAD specific primers that flank the deletion mutation found in BALB/cByJ mice. The upper fragment [870 bp (6)] is found in all wild-type mice (BALB/cJ, BALB/cBy and the other unrelated strains), while the lower band 278 bp shorter is found only in BALB/cByJ mice, and both fragments are found in the Fl hybrids. REFERENCES. 1. Seeley T.-L., Holmes R.S. (1980) Biochem. Genet. 19: 333-345. 2. Prochazka M., Leiter E.H. (1986) Mouse News Lett. 78:31. 3. Wood, P.A., Amendt, B.A., Rhead, W.J., Millington, D.S., Inoue, F., and Armstrong, D. (1989) Pediatr. Res. 25: 38-43. 4. Schiffer, S.P., Prochazka, M., Jezyk, P.F., Roderick, T.H., Yudkoff, M., and Patterson, D.F. (1989) Biochem. Genet. 27: 47-58. 5. Kelly C.L., Hinsdale M.E., Wood P.A. (1992) Amer. J. Hum. Genet. 51:A88. 6. Hinsdale M.E., Kelly C.L., Wood P.A. (1993) Genomics, in press. 7. Amendt B.A., Freneaux E., Reece C., Wood, P.A., Rhead W.J. (1992) Pediat. Res. 31:552-556. |
