|  Help  |  About  |  Contact Us

Allele : Pold1<em1Ewht> polymerase (DNA directed), delta 1, catalytic subunit; endonuclease-mediated mutation 1, Eileen White

Primary Identifier  MGI:7797727 Allele Type  Endonuclease-mediated
Gene  Pold1 Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Using CRISPR technology, a sgRNA (CCCGAGAGATGAGGTATGGG) was designed to target the endonuclease domain of the Pold1 gene to introduce GAC to GCA mutations resulting in an aspartic acid to alanine change at amino acid 400 (D400A).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Pold1 D400A,
  • Pold1 D400A
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele