| Help | About | Contact Us

Allele : Pold1<em1Ewht> polymerase (DNA directed), delta 1, catalytic subunit; endonuclease-mediated mutation 1, Eileen White

Primary Identifier	MGI:7797727	Allele Type	Endonuclease-mediated
Gene	Pold1	Strain of Origin	C57BL/6J
Is Recombinase	false	Is Wild Type	false

molecularNote

Using CRISPR technology, a sgRNA (CCCGAGAGATGAGGTATGGG) was designed to target the endonuclease domain of the Pold1 gene to introduce GAC to GCA mutations resulting in an aspartic acid to alanine change at amino acid 400 (D400A).

mutations:
Nucleotide substitutions

synonyms:
Pold1 D400A,
Pold1 D400A

earliestPublication:
The Jackson Laboratory (2005) Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

Other

1 Carried By

0 Driven By

2 Publication categories

Questions? Comments? Click here!

MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Your name:
Your email address:
Subject:
Message:	---- Current page: ---- /mousemine/report.do?id=76910622

MouseMine