|  Help  |  About  |  Contact Us

Allele : Zmynd19<em1(IMPC)J> zinc finger, MYND domain containing 19; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5907980 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zmynd19
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAGGACCCCAAAAGTACAG, TCCGTTCTGGACTTTTTTAA, GTAACCTATGACTCACCAGA and GAGCTTTGCCACTAACCCAA, which resulted in a 461 bp deletion beginning at Chromosome 2 positive strand position 24952462 bp, TACTTTTGGGGTCCTAGGAG, and ending after TGAGACCCATGGATCCTTCT at 24952922 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261744 (exon 3) and 354 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 76 bp insertion into the site of the deletion that is an inverted repeat from Chr2:24952847-24952922 (AGAAGCTTTG). The insertion is not expected to alter the results of the exon deletion, which is predicted to cause a change of amino acid sequence after residue 37 and early truncation 39 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele