| Primary Identifier | MGI:5907980 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zmynd19 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAGGACCCCAAAAGTACAG, TCCGTTCTGGACTTTTTTAA, GTAACCTATGACTCACCAGA and GAGCTTTGCCACTAACCCAA, which resulted in a 461 bp deletion beginning at Chromosome 2 positive strand position 24952462 bp, TACTTTTGGGGTCCTAGGAG, and ending after TGAGACCCATGGATCCTTCT at 24952922 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261744 (exon 3) and 354 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 76 bp insertion into the site of the deletion that is an inverted repeat from Chr2:24952847-24952922 (AGAAGCTTTG). The insertion is not expected to alter the results of the exon deletion, which is predicted to cause a change of amino acid sequence after residue 37 and early truncation 39 amino acids later. |