| Primary Identifier | MGI:6109968 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Wdr41 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TAATACATACCAGTTCTACA, GGCCCAGTAGTTTTAAAGTC, TAAATGCTACAATTTTCAGT and TCTTTGTCAGCATTGACCAC, which resulted in a 391 bp deletion beginning at Chromosome 13 positive strand position 94,978,329 bp and ending after 94,978,719 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001262273 (exon 2) and 275 bp of flanking intronic sequence including the splice acceptor and donor. In addition, 96 bp before the 391 bp deletion there are 2 small intronic indels, a 5 bp (GTTGA) insertion followed 8 bp after that insertion by an 11 bp deletion (GTAGTTTTAAA) that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 17 and early truncation 6 amino acids later. |
