|  Help  |  About  |  Contact Us

Allele : Dbn1<em1(IMPC)J> drebrin 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5645712 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dbn1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Dbn1-6662J-M9006 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, CCTACACCCGTCACCCTGCA, TGACGCTGCAGAAACCATAC and GGTGGAATGTGGCCGCTCCG, (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 108bp deletion beginning in intron 3 at GTAGGAGATGGGGAGTCCCAA at Chromosome 13 negative strand position 55,482,845 bp (GRCm38) and ending after ATGTATGGTTTCTGCAGCGT at position 55,482,738 bp in exon 3. This mutation deletes part of exon 3 and is predicted to cause amino acid sequence changes after residue 47 and early truncation 46 amino acids later. This allele also has an additional 48bp deletion in intron 4 from Chromosome 13 negative strand position 55,482,666 bp to 55,482,619 bp, which is not expected to affect the protein. PCR failed to detect the insertion of any loxP sites.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Dbn1<em1J>,
  • Dbn1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele