| Primary Identifier | MGI:5645712 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dbn1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Dbn1-6662J-M9006 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, CCTACACCCGTCACCCTGCA, TGACGCTGCAGAAACCATAC and GGTGGAATGTGGCCGCTCCG, (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 108bp deletion beginning in intron 3 at GTAGGAGATGGGGAGTCCCAA at Chromosome 13 negative strand position 55,482,845 bp (GRCm38) and ending after ATGTATGGTTTCTGCAGCGT at position 55,482,738 bp in exon 3. This mutation deletes part of exon 3 and is predicted to cause amino acid sequence changes after residue 47 and early truncation 46 amino acids later. This allele also has an additional 48bp deletion in intron 4 from Chromosome 13 negative strand position 55,482,666 bp to 55,482,619 bp, which is not expected to affect the protein. PCR failed to detect the insertion of any loxP sites. |