|  Help  |  About  |  Contact Us

Allele : Arhgap10<em1(IMPC)Tcp> Rho GTPase activating protein 10; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6281939 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arhgap10
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1260 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs with spacer sequences of TAAAAGAGCCATCTACGGGG and GTGTAAAACAGTCAATCGAG targeting the 5' side and CTTCGATCTGAAGAGTCGGG and GCACATCACTAGATAGCATG targeting the 3' side of a critical exon. This resulted in a 5-bp deletion on Chr8: 77413906 to 77413910, a 351-bp deletion on Chr8: 77413460 to 77413810, and a 3-bp deletion Chr8: 77413310 to 77413312 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele