|  Help  |  About  |  Contact Us

Allele : Slc13a5<em3(SLC13A5*)Lutzy> solute carrier family 13 (sodium-dependent citrate transporter), member 5; endonuclease-mediated mutation 3, Cathy Lutz

Primary Identifier  MGI:7619936 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence, Inserted expressed sequence, Null/knockout Gene  Slc13a5
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 endonuclease-mediated genome editing used a guide RNAs (CGCCGAATCCATCGCGTGAA, GCCGAATCCATCGCGTGAAA, TGCGTGTCTGGGCAGCCTGG, AGTTGCGTGTCTGGGCAGCC) to excise and replace coding murine exon 1 of the Slc13a5 with a full-length 568 amino acid human SLC13A5 cDNA with G219R missense variant and bGH poly(A) transcription termination signal. The insertion prevents translation of the mouse Slc13a5 cDNA. Slc13a5 transcript Slc13a5-201 (ENSMUST00000021161.14) was used as reference for the exon number and guide sequences.
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

1 Expresses

Trail: Allele

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele