| Primary Identifier | MGI:7619936 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Inserted expressed sequence, Null/knockout | Gene | Slc13a5 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 endonuclease-mediated genome editing used a guide RNAs (CGCCGAATCCATCGCGTGAA, GCCGAATCCATCGCGTGAAA, TGCGTGTCTGGGCAGCCTGG, AGTTGCGTGTCTGGGCAGCC) to excise and replace coding murine exon 1 of the Slc13a5 with a full-length 568 amino acid human SLC13A5 cDNA with G219R missense variant and bGH poly(A) transcription termination signal. The insertion prevents translation of the mouse Slc13a5 cDNA. Slc13a5 transcript Slc13a5-201 (ENSMUST00000021161.14) was used as reference for the exon number and guide sequences. |