| Primary Identifier | MGI:7428455 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pgm1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 mediated recombination targeting exons 2 and 3 with sgRNAs (targeting CGAGGTCTACCTTCAAGTCA and GGATGATGCAAGATACGGCA) created an insertion (AC) and deletion (CGTA) mutation in exon 2 resulting in a frameshift mutation at valine codon 99 (GTA) and a premature stop codon 60 nucleotides/20 codons downstream (Val99Leufs*20). |
