|  Help  |  About  |  Contact Us

Allele : Pgm1<em1Laik> phosphoglucomutase 1; endonuclease-mediated mutation 1, Kent Lai

Primary Identifier  MGI:7428455 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pgm1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 mediated recombination targeting exons 2 and 3 with sgRNAs (targeting CGAGGTCTACCTTCAAGTCA and GGATGATGCAAGATACGGCA) created an insertion (AC) and deletion (CGTA) mutation in exon 2 resulting in a frameshift mutation at valine codon 99 (GTA) and a premature stop codon 60 nucleotides/20 codons downstream (Val99Leufs*20).
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Pgm2<->,
  • Pgm2<em1Laik>,
  • Pgm2<->,
  • Pgm2<em1Laik>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories