| Primary Identifier | MGI:6106859 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cntnap3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGAAGTCTCATAACACT, AAGTAATTTTTAACTGACGC, TCACTCTGCCTATATCCAAA and ATTATCATAGCTTATATCAA, which resulted in a 278 bp deletion beginning at Chromosome 13 negative strand position 64,799,280 bp and ending after 64,799,003 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000321093 (exon 4) and 130 bp of flanking intronic sequence including the splice acceptor and donor. There are 2 additional small deletions, a 5 bp (GGATA) deletion 29 bp before the exon deletion and a 2 bp deletion (GT) 53 bp after he 278 bp deletion, neither of which will alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 133 and early truncation 21 amino acids later. |
