| First Author | Lang J | Year | 1991 |
| Journal | Mouse Genome | Volume | 89 |
| Issue | 4 | Pages | 857 |
| Mgi Jnum | J:1779 | Mgi Id | MGI:50303 |
| Citation | Lang J (1991) Assay for deletion in Gnrh (hpg) locus using PCR. Mouse Genome 89(4):857 |
| abstractText | Full text of Mouse Genome contribution: ASSAY FOR DELETION IN Gnrh (hpg) LOCUS USING PCR. Jill Lang, Department of Human Anatomy, South Parks Road, Oxford, 0X1 3QX Introduction. The hypogonadal (hpg) mouse1 has underdeveloped reproductive tracts in both sexes caused by a recessive 33.5kb deletion in the hypothalamic gonadotrophin-releasing hormone (Gnrh) gene2 which reduces luteinizing hormone (LH) and follicle-stimulating hormone (FSH). Homozygous male hpg mice can be identified visually when a week old and females at three weeks but, previously, the phenotypically normal carriers could only be discovered by crossing. Using the polymerase chain reaction (PCR)3 a region of DNA around the deletion can be amplified and from the size of the product(s) the genotype deduced. As only a small tissue sample is needed new-born mice can be characterized. Sixty assays can be handled a day. The assay therefore both facilitates developmental studies and eases the management of the colony. Position of primers relative to the deletion in Gnrh gene. Three oligonucleotide primers are used for the amplification; A 5' of the deletion, B 3' of the deletion in the hpg and C 3' of the point of the deletion in the normal (see figure). All three primers are present in each reaction but as 33.5kb is not spanned by PCR no band of that size is generated with normal DNA. The sequence of the primers was obtained from2. Primer: Location: Sequence: A 2223 - 2242bp (Mason's numbering) 5' CACATCTGTAGCCACAGTCC B 86 - 105bp (from deletion) 5' AGCTCCGAGGCTGTCACTGG C 2913 - 2932bp (Mason's numbering) 5' GCTTGGAGAGCTGTAAGGTC The sequences of B and C are complementary to the published sequence and have been written conventionally 5' to 3'. Assay. The assay has four steps. Tissue sampling. A very small tissue sample is used - <0.5mm of tail tip. Lysis. DNA is liberated by incubating the sample for 1 hour at 55 degrees C in 200ul lysis mix (100mM KC1, 10mM Tris pH8.2, 1% Triton X-100, 0.45% Tween-20, and 60mg/ml Proteinase K). Heat the lysate at 98 degrees C (or boil) for 15 minutes to inactivate the Proteinase K and any nucleases. PCR. The lysate is shaken and centrifuged for 5 minutes at 12,000g. Transfer 10ul lysate to PCR tube, add 10ul PCR mix (4 pmoles each of primers A, B and C (1 pmole = 6.6ng 20mer); 2mM MgCl2; 200uM each of dATP, dCTP, dGTP, dTTP; 0.1 Taq polymerase). To prevent evaporation during cycling the sample is overlaid with 1 drop mineral oil. Cycle 25 - 30 times. I use a 28 cycle regime starting with an initial 5 minute denature at 92 degrees C followed by 15 seconds anneal at 60 degrees C and 1 minute extension at 72 degrees C. The subsequent denature periods are 15 seconds and the final 8 extensions are of 2 minutes. Electrophoresis. Fragments of this size can be separated on a TEB 1.5% agarose gel containing Ethidium bromide4. Visualise the bands with UV light, photograph and score the samples:- + one 712bp band; +/hpg both 712bp and 586bp bands; hpg one 586bp band (see photograph). Conclusion. The assay is rapid (the number of samples that can be handled in a day is limited only by the capacity of the thermocycler) and, as the volume is small, economical. In the first report of the hpg1 it was doubted if hpg inheritance was classically Mendelian. I assayed 32 litters containing 183 mice and found 37 (20.2%) +, 103 (56.3%) +/hpg and 43 (23.5%) hpg which does not differ significantly from the Mendelian pattern of inheritance (X2=3.2; d.f.=2; p=0.2). References. 1 CATTANACH, B.M. et al. (1977). Nature 269 338-340. 2 MASON, A. J. et al. (1986). Science 234 1366-1371. 3 ERLICH, H. (ed.) (1989). PCR technology: principles and applications for DNA amplification. 4 SAMBROOK, J. et al. (1989). Molecular cloning. This work was supported by the Wellcome Trust. |
