| Primary Identifier | MGI:6755465 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc87 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCTCAAGCCGATTTACCAC and GTGAGTAGTGGGAGTATTCC, which resulted in a 2506 bp deletion beginning at Chromosome 19 position 4,889,552 bp and ending after 4,892,057 bp (GRCm39/mm39). This mutation deletes 2506 bp from ENSMUSE00000553699 (exon 1) coding sequence and is predicted to cause a change of amino acid sequence after residue 14 and termination 22 amino acids later. |
