|  Help  |  About  |  Contact Us

Allele : Pwwp2b<em1(IMPC)J> PWWP domain containing 2B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6385154 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pwwp2b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGATGGAGACAGGCCAAAG and TTCTGGGGCCACGTGTTGTG, which resulted in a 1631 bp deletion beginning at Chromosome 7 position 139,254,777 bp and ending after 139,256,407 bp (GRCm38/mm10). This mutation deletes 1631 bp from ENSMUSE00000911429 (exon 2) and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 10 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories