|  Help  |  About  |  Contact Us

Allele : Pycr3<em1(IMPC)J> pyrroline-5-carboxylate reductase 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6383391 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pycr3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACAGACATTGGTGACCCA and AATTGACTTGATCAGCCCCA, which resulted in a 452 bp deletion beginning at Chromosome 15 position 75,918,943 bp and ending after 75,919,394 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000128499 (exon 2) and 387 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 10 amino acids later. There is a 2 bp insertion (AA) at the deletion site.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories