|  Help  |  About  |  Contact Us

Allele : Impg1<em1Bdph> interphotoreceptor matrix proteoglycan 1; endonuclease-mediated mutation 1, Benjamin Philpot

Primary Identifier  MGI:7619087 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Impg1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 5 was deleted using two sgRNAs targeting introns 4 (CTGTTGTGGACCGAATACAG) and 5 (TTCAAATCGCTAATTTCTCA) and an ssODN template (for the desired deletion junction) with CRISPR/Cas9 technology.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Impg1 KO,
  • Impg1 KO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories