|  Help  |  About  |  Contact Us

Allele : Flt3<tm1Dgg> FMS-like tyrosine kinase 3; targeted mutation 1, D Gilliland

Primary Identifier  MGI:3763385 Allele Type  Targeted
Attribute String  Humanized sequence Gene  Flt3
Transmission  Germline Strain of Origin  (129X1/SvJ x 129S1/Sv)F1-Kitl<+>
Is Recombinase  false Is Wild Type  false
molecularNote  The human W51 mutation which causes the duplication of amino acid 595 to 601 (REYEYDL; AGAGAATATGAATATGATCTC) was inserted in-frame into exon 14, replacing the endogenous single copy (RDYEYDL; AGGGACTATGAATATGACCTT). A loxP site flanked neomycin selection cassette was inserted into intron 15.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • FLT3/ITD,
  • FLT3/ITD,
  • Flt3<ITD>,
  • Flt3<ITD>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

71 Publication categories