| Primary Identifier | MGI:3763385 | Allele Type | Targeted |
| Attribute String | Humanized sequence | Gene | Flt3 |
| Transmission | Germline | Strain of Origin | (129X1/SvJ x 129S1/Sv)F1-Kitl<+> |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The human W51 mutation which causes the duplication of amino acid 595 to 601 (REYEYDL; AGAGAATATGAATATGATCTC) was inserted in-frame into exon 14, replacing the endogenous single copy (RDYEYDL; AGGGACTATGAATATGACCTT). A loxP site flanked neomycin selection cassette was inserted into intron 15. |