| Primary Identifier | MGI:3798495 | Allele Type | Chemically induced (ENU) |
| Gene | Srr | Inheritance Mode | Dominant |
| Strain of Origin | C57BL/6JJcl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | RIKEN GSC ENU Project |
| molecularNote | This mutation was identified in an ENU mutagenesis screen. The molecular lesion is in a G-to-A mutation in an intron (gtccactaccggtaaataaac). |
