|  Help  |  About  |  Contact Us

Allele : Npm1<tm1Gsva> nucleophosmin 1; targeted mutation 1, George S Vassiliou

Primary Identifier  MGI:5004857 Allele Type  Targeted
Attribute String  Conditional ready, Humanized sequence Gene  Npm1
Transmission  Germline Strain of Origin  Not Specified
Is Recombinase  false Is Wild Type  false
molecularNote  A loxP site was inserted into intron 10 and a puromycin resistance gene cassette, a second loxP site and a modified exon 11 into intron 11. The exon modification involves replacing the end of the endogenous coding sequence and start of 3' UTR with the equivalent sequence for the human A variant of NPM1, which has a frameshift and slightly longer translated sequence: mouse sequence GCAGTGGAGGAAATCTCTTTAAGAAAAGG (reverse strand) was replaced with human sequence TCTGGCAGTGGAGGAAGTCTCTTTAAGAAAATA.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Npm1<flox-cA>,
  • Npm1<flox-cA>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

16 Publication categories