|  Help  |  About  |  Contact Us

Allele : Rr249<tm1.1Ebres> regulatory region 249; targeted mutation 1.1, Emery H Bresnick

Primary Identifier  MGI:5466176 Allele Type  Targeted
Gene  Rr249 Transmission  Germline
Strain of Origin  129S1/Sv-Oca2<+> Tyr<+> Kitl<+> Is Recombinase  false
Is Wild Type  false
molecularNote  A loxP site flanked neomycin resistance gene cassette replaced the 46 bp E-box GATA motif (CATCTGCAGCCGGTAGATAA; WGATAR) at the +9.5 kb Gata2 enhancer site in intron 4. Cre-mediated recombination removed the neo cassette. RT-PCR confirmed reduced transcript expression in the liver.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • Gata2<tm1.1Ebres>,
  • Gata2<tm1.1Ebres>,
  • +9.5<->,
  • +9.5<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

8 Publication categories