|  Help  |  About  |  Contact Us

Allele : Tyr<em3J> tyrosinase; endonuclease-mediated mutation 3, Jackson

Primary Identifier  MGI:5470270 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tyr
Inheritance Mode  Recessive Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
molecularNote  This zinc finger mediated allele was generated at The Jackson Laboratory and is a 24 bp deletion of AGGGACCACTATTACGTAATCCTG from Chromosome 7 negative strand position 87,483,953 bp through 87,483,976 bp (GRCm38/mm10), which results in a recessive albino phenotype. This is predicted to cause an 8 amino acid in-frame deletion of amino acids 295-302, GPLLRNPG, near the center of the di-copper centre-containing domain, but is not predicted to cause a premature truncation or frameshift.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories