| Primary Identifier | MGI:5470270 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tyr |
| Inheritance Mode | Recessive | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This zinc finger mediated allele was generated at The Jackson Laboratory and is a 24 bp deletion of AGGGACCACTATTACGTAATCCTG from Chromosome 7 negative strand position 87,483,953 bp through 87,483,976 bp (GRCm38/mm10), which results in a recessive albino phenotype. This is predicted to cause an 8 amino acid in-frame deletion of amino acids 295-302, GPLLRNPG, near the center of the di-copper centre-containing domain, but is not predicted to cause a premature truncation or frameshift. |