|  Help  |  About  |  Contact Us

Allele : Gt(ROSA)26Sor<tm2Jake> gene trap ROSA 26, Philippe Soriano; targeted mutation 2, John A Kessler

Primary Identifier  MGI:5474352 Allele Type  Targeted
Gene  Gt(ROSA)26Sor Transmission  Germline
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  A cassette, consisting of the CAG (CMV-chicken beta actin) promoter, a splice acceptor site, a floxed pgk-neo stop construct, and the mouse Mir21 sponge sequence, was inserted via homologous recombination. The sponge sequence contained seven Mir21 binding sites (sequence UCAACAUCAGGACAUAAGCUA). This sequence acts as a competitive inhibitor for the microRNA.
  • mutations:
  • Insertion
  • synonyms:
  • ROSA-MSP,
  • ROSA-MSP
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

5 Publication categories