|  Help  |  About  |  Contact Us

Allele : Rr557<em2Jdean> regulatory region 557; endonuclease-mediated mutation 2, Jurrien Dean

Primary Identifier  MGI:7730911 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr557
Strain of Origin  C57LB/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The Ptgs2 enhancer, located upstream in a Ptgs2os intron, was targeted using crRNAs (equivalent to GTGAAGTGGCCCTGGCGTCATGG and ATATTGTGTTCGATTCTACAAGG) with CRISPR/Cas9 technology, resulting in an 813 bp deletion (GRCm39:chr1:149964766-149965578).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • delta813,
  • delta813
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories