| Primary Identifier | MGI:7730911 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr557 |
| Strain of Origin | C57LB/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Ptgs2 enhancer, located upstream in a Ptgs2os intron, was targeted using crRNAs (equivalent to GTGAAGTGGCCCTGGCGTCATGG and ATATTGTGTTCGATTCTACAAGG) with CRISPR/Cas9 technology, resulting in an 813 bp deletion (GRCm39:chr1:149964766-149965578). |
