| Primary Identifier | MGI:7568797 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zbtb10 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ACTCCAAAAGAAGTCTATCA and AACAGACTCTTTCTGACTTA. This resulted in a 1,283 bp deletion of Chr3:9,264,341-9,265,623 (GRCm38/mm10) that removes exon ENSMUSE00000769877. |