|  Help  |  About  |  Contact Us

Allele : Sfxn2<em1(IMPC)J> sideroflexin 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7568767 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sfxn2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCGAGATGGATGAACACGT and CCTCAAATATCAGGGTGGGA, which resulted in a 2681 bp deletion beginning at Chromosome 19 position 46,587,902 bp and ending after 46,590,582 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000147421,ENSMUSE00000147411, ENSMUSE00000147418, and ENSMUSE00000147415 (exons 5-8) and 2391 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 143 and early stop 50 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories