| Primary Identifier | MGI:7568767 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sfxn2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCGAGATGGATGAACACGT and CCTCAAATATCAGGGTGGGA, which resulted in a 2681 bp deletion beginning at Chromosome 19 position 46,587,902 bp and ending after 46,590,582 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000147421,ENSMUSE00000147411, ENSMUSE00000147418, and ENSMUSE00000147415 (exons 5-8) and 2391 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 143 and early stop 50 amino acids later. |
