|  Help  |  About  |  Contact Us

Allele : Arx<tm5Kki> aristaless related homeobox; targeted mutation 5, Kunio Kitamura

Primary Identifier  MGI:5559563 Allele Type  Targeted
Gene  Arx Transmission  Germline
Strain of Origin  129S/SvEv-Gpi1<c> Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 2 was replaced with one in which coding nucleotide 437 (T), the second base in valine codon 146 at the start of the second poly-alanine stretch, was replaced with a C and had a duplication of nucleotides coding for poly-alanine sequence inserted after it (c.437T>CGGCTGCCGCCGCTGCCGCTGCAGC). Note that this duplicated sequence cannot be found as a contigous sequence in either C57BL/6J or 129S1/SvImJ, but rather as two separate sequences in two separate poly-alanine stretches in exon 2. This results in a protein with a longer second poly-alanine repeat (p.(V146delinsAAAAAAAAA)). A neomycin resistance cassette was inserted into intron 1. Western blot analysis showed reduced protein expression.
  • mutations:
  • Single point mutation,
  • Insertion
  • synonyms:
  • Arx<432-455dup24>,
  • Arx<432-455dup>,
  • Arx<432-455dup24>,
  • Arx<432-455dup>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

9 Publication categories