| Primary Identifier | MGI:5565206 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Adad2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Adad2-5594J-B was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CCCATGCTCAGCGGTCCTAG, which resulted in an 8 bp deletion CTAGGACC and a 4 bp insertion ATGA in exon1 beginning at Chromosome 8 positive strand position 119612902 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. |
