|  Help  |  About  |  Contact Us

Allele : Mir181d<tm1.1Oers> microRNA 181d; targeted mutation 1.1, Nicolai S C van Oers

Primary Identifier  MGI:5576230 Allele Type  Targeted
Attribute String  Null/knockout Gene  Mir181d
Transmission  Germline Strain of Origin  C57BL/6
Is Recombinase  false Is Wild Type  false
description  ES cell line = LR2.6.1
molecularNote  The hairpin loopwas eliminated and several additional nucleotides were introduced to create a new Pst I restriction site. The original sequence was acaattaacattcattgttgtcggtgggttg and the new sequence was acaattaagtgctaatgttgtccctgcagtgtg. A floxed neo selection cassette was subsequently removed by cre excision. Northern blot analhysis confirmed the lack of mature transcript without effecting expression of Mir181c.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Mir181d tm1Oers,
  • Mir181d tm1Oers
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

7 Publication categories