| Primary Identifier | MGI:5576230 | Allele Type | Targeted |
| Attribute String | Null/knockout | Gene | Mir181d |
| Transmission | Germline | Strain of Origin | C57BL/6 |
| Is Recombinase | false | Is Wild Type | false |
| description | ES cell line = LR2.6.1 |
| molecularNote | The hairpin loopwas eliminated and several additional nucleotides were introduced to create a new Pst I restriction site. The original sequence was acaattaacattcattgttgtcggtgggttg and the new sequence was acaattaagtgctaatgttgtccctgcagtgtg. A floxed neo selection cassette was subsequently removed by cre excision. Northern blot analhysis confirmed the lack of mature transcript without effecting expression of Mir181c. |
