|  Help  |  About  |  Contact Us

Allele : Fxn<em1(IMPC)J> frataxin; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5571595 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fxn
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Fxn-5659J-106A was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AGTAGCATGTGGGCGTTCGG, which resulted in a 4 bp deletion TTCG in exon 1 beginning at Chromosome 19 negative strand position 24,280,560 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Fxn<em1J>,
  • Fxn<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories