| Primary Identifier | MGI:5571595 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fxn |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Fxn-5659J-106A was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AGTAGCATGTGGGCGTTCGG, which resulted in a 4 bp deletion TTCG in exon 1 beginning at Chromosome 19 negative strand position 24,280,560 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. |