|  Help  |  About  |  Contact Us

Allele : Exoc4<em1(IMPC)J> exocyst complex component 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5571596 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Exoc4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Exoc4-5677J-3730 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ACCGAGATGAGCAGCCCCGA, which resulted in a 10 bp deletion GGGGCTGCTC beginning at Chromosome 6 positive strand 33249215 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Exoc4<em1J>,
  • Exoc4<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories