| Primary Identifier | MGI:5571597 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mpdz |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Mpdz-5657J-A was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and guide sequences GCAGGATGCTAATGGCCTGC and TGCCAGAGGATCTTTGCCGC, which resulted in a 136 bp deletion of TGTGATTGCCAGAGGATCTTTGCCGCCGGTCTCCAGCCCACGGATTTCCCGCTCTCCATCAGCAGCCAGCACCATTTCAGCCCACTCGAATCCAGTGAGTAGCAGAGGCCCAGGATCGGAAGGTGCCACCTCTGGT and a 29 bp insertion of AATAACCCTAAAAGGTTAAAATATTAAAC in exon 6 beginning at Chromosome 4 negative strand position 81383820 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. |
