|  Help  |  About  |  Contact Us

Allele : Mpdz<em1(IMPC)J> multiple PDZ domain crumbs cell polarity complex component; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5571597 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mpdz
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Mpdz-5657J-A was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and guide sequences GCAGGATGCTAATGGCCTGC and TGCCAGAGGATCTTTGCCGC, which resulted in a 136 bp deletion of TGTGATTGCCAGAGGATCTTTGCCGCCGGTCTCCAGCCCACGGATTTCCCGCTCTCCATCAGCAGCCAGCACCATTTCAGCCCACTCGAATCCAGTGAGTAGCAGAGGCCCAGGATCGGAAGGTGCCACCTCTGGT and a 29 bp insertion of AATAACCCTAAAAGGTTAAAATATTAAAC in exon 6 beginning at Chromosome 4 negative strand position 81383820 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • Mpdz<em1J>,
  • Mpdz<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele